Contact Us

Tel:0371-63387308
      0371-65330928
E-mail:guoshuxuebao@caas.cn

Home-Journal Online-2023 No.12

Development and evaluation of specific molecular target of Dajao

Online:2023/12/20 16:30:37 Browsing times:
Author: WANG Fang, CUI Guangjuan , LÜ Shun, ZENG Lisha, CHEN Dongyi, HUANG Xiaoyan, ZENG Guoling, LIU Wenqing, HE Jianqi
Keywords: Dajiao; Molecular target; Specificity identification; Mitochondrial gene; Evaluation
DOI: 10.13925/j.cnki.gsxb.20230343
Received date:
Accepted date:
Online date:
PDF () Abstract()

Abstract:【Objective】Banana is an important fruit and food crop in the world, but it is facing the technical bottleneck of resource identification and genetic improvement. Banana plants are asexual and highly sterile. Because of long-term cultivation and exchanging between different regions, the origin of banana varieties is not clear. China has abundant cultivated and wild banana resources. Dajiao (Musa) is one of widely distributed banana resources in China which is different from plantain abroad, and there are many different types of Dajiao in different growing areas. Dajiao has many advantages, such as high yield, cold resistance, and strong disease resistance, so Dajiao is an important genetic resource. The aim of this study was to develop a specific molecular target of Dajiao for the rapid identification and genetic improvement of Chinese banana resources.【Methods】The 96 samples of different banana resources used in this experiment included 6 cultivars of Cavendish, 9 cultivars of Pisang Awak, 1 cultivar of Longya banana, 4 cultivars of Pisang Mas, 37 cultivars of Dajiao, 3 wild resources of Musa acuminata, 6 wild resources of Musa balbisiana, 5 wild resources of Musa basjoo, 21 wild resources of Musa itinerans and 3 hybrids, which were collected from different producing areas of China. The genomic DNA from each sample was isolated from fresh young cigar leaves using CTAB method. The concentration and purity of each DNA were checked with BioDrop μLite. First, we selected eight varieties of four groups, including Huanong Zhongba Dajiao, Dongguan Zhongba Dajiao, 8818-1, Beida Aijiao, Zhong-fen No. 1, Fenza No. 1, Gongjiao and Gongxuan as representatives, through cloning and sequencing of the mitochondrial gene cox2/2-3, and aligning the sequences by Mega 5.0. We found the specific base sequence in Dajiao from the results. Then Primer Premier 5.0 was used to design the specific primer, the optimal PCR amplification system and agarose gel electrophoresis detection method were optimized. At last, we obtained the specific detection target through a certain range of screening and expanded range of validation.【Results】The concentration of DNA extraction reached 500-1000 ng · μL- 1 , OD260/OD280 = 1.8-2.0, and the quality was good, which met the requirements of the experiment. The DNA was finally diluted into 50 ng·μL-1 and used for the experiments. PCR amplification of the cox2/2-3 region produced a single fragment of about 750-1200 bp in all the samples, and the gene fragment of Dajiao was longest, about 1200 bp. Through comparing the gene sequence of eight banana resources, we found 9 different insertional mutations (175 bp in total) in Dajiao, located at 229- 985 bp of this gene. The abundant variation facilitated the design of specific primers. According to the specificity of cox2/2-3 gene sequence in Dajiao, a pair of primers was designed, the forward primer was DCR: TATTGACCGGTATGTCGGTA, and the rewerse primer was DCF: AGGTATTAATTGGCGGCCTAA. The optimal PCR procedure was: 94 ℃ predenaturation for 3 min, 94 ℃ denaturation for 30 s, 60 ℃ annealing for 30 s, 72 ℃ extension for 1 min, 30 cycles, 72 ℃ extension for 10 min, 94 ℃ denaturation for 30 s, 60 ℃ annealing for 30 s, 72 ℃ extension for 10 min. The optimal PCR system was: 10×PCR reaction buffer 2.5 μL, 2.5 nmol·L-1 dNTPs 2 μL, 10 μmol·L-1 primer 1 μL, 50 ng·μL-1 template DNA 1 μL, 5 U· μL-1 TaqDNA polymerase 0.5 μL, the volume was replenished to 25 μL with sterilized double-distilled water. The optimal detection method was: 1.2% agarose gel, 0.5×TBE electrode buffer, 110 V electrophoresis for 30 min. Through the examination, a 634 bp specific band was found in all 37 banana resources of Dajiao, but not in banana resources of Cavendish, Pisang Awak, Pisang Mas and Longyajiao. The target band was clear, no miscellaneous band and the detection accuracy was 100% in cultivated species. Only M. itinerans showed this specific band in the detection of wild banana using this marker, no specific band was found in M. acuminata, M. balbisiana and M. basjoo. At the same time, the specific band appeared in 3 hybrid progenies, so this fragment would be also suitable for the identification of hybrid progenies from Dajiao × M. itinerans. Banana had a unique inheritance mode of mitochondrial paternal inheritance as reported early, and this specific molecular target was derived from mitochondrial genes. On the whole, the 634 bp special band appeared in 37 cultivars of Dajiao and 22 wild resources of M. itinerans, so there should be a certain relationship between the paternal origin of Dajiao and M. itinerans.【Conclusion】Compared with traditional evaluation method using morphological markers, this specific molecular target of Dajiao would be more stable, sensitive and accurate and could be efficiently used in selection of parents and early identification of hybrid offspring in cross breeding , the results of this study about Dajiao and M. itinerans would provide information for studying the origin and evolution of bananas.