Contact Us

Tel:0371-63387308
      0371-65330928
E-mail:guoshuxuebao@caas.cn

Home-Journal Online-2022 No.11

Establishment and application of dot-ELISA detection method for Citrus chlorotic dwarf-associated virus

Online:2023/1/3 7:16:43 Browsing times:
Author: QIN Yangyang, CHEN Xiangling, WANG Jiajun, YE Xiao, SHEN Shikai, ZHOU Yan
Keywords:
DOI: 10.13925/j.cnki.gsxb.20220275
Received date:
Accepted date:
Online date:
PDF () Abstract()

Abstract:【Objective】In 2015, a new citrus viral disease caused by Citrus chlorotic dwarf-associated virus (CCDaV) was discovered in Yunnan province of China, and since then it has spread in some important citrus-growing provinces of China, like Guangxi and Yunnan. At present, the main control strategy for prevention of CCDaV is based on using virus- free germplasm and propagation materials. To date, various techniques have been employed to detect CCDaV, including biological indexing, PCR and qPCR. However, these conventional detection techniques generally suffer from drawbacks. The purpose of this research was to establish a sensitive, accurate and high-throughput detection method for CCDaV, so as to provide technical support for the diagnosis and production of virus-free citrus plants in China. 【Methods】The restriction enzymes BamHⅠand XhoⅠwere added to the corresponding end of the CCDaV- CP gene sequence, respectively. Primers F (5’- GTGGACAGCAAATGGGTCGCG-GATCCCCATGTAAAACACACACGGTGGATGTGAT- 3’) and R (5’- CAGTGGTGGTGGTGGTGGTGCTCGAGTTAATTT GATGTAGAATCATAAA AA TA CA- 3’) were designed using SNAPGENE software based on a region (84-762 nt) of coat protein (CP) gene that was highly conserved across 15 full CCDaV genome sequences available in GenBank. Total DNA was extracted from 0.1 g CCDaV-infected citrus sample and amplified by PCR with primers F/R. The reaction was conducted under condi-tions of initial 3 min denaturation at 98 ℃, 34 cycles at 98 ℃ for 10 s, 60 ℃ for 15 s, 72 ℃ for 40 s and extension for 5 min at 72 ℃. The PCR purified products and pET28a vector were digested by BamHⅠ and XhoⅠ, and after that they were ligated with T4 DNA ligase and transferred into Escherichia coli (E. coli) strain DH5α and finally plated onto Luria-Bertani (LB) agar containing Kanamycin (Kana). The expression strain Rosetta containing the recombinant plasmid was cultured at 37 ℃ overnight, and transferred to a new medium at a 10% inoculum on the second day, until OD600 reached 0.4-0.6. Isopro-pyl-β-D-thiogalactoside (IPTG) was added to a final concentration of 0.1, 0.3, 0.5, 0.7 and 0.9 mmol, and incubated at 18 ℃ overnight. The expressed protein was purified and then used to immune rabbit. The optimal titer of the antiserum was tested by Western blot. Based on the prepared antiserum, dotELISA was developed for detecting CCDaV in citrus by optimizing the titer of the primary antibody and goat-anti-rabbit second antibody. The specificity of the established dot-ELISA was evaluated by detecting the samples infected with CCDaV, Citrus tristeza virus (CTV), Citrus yellow vein clearing virus (CYVCV), Citrus psorosis virus (CPV) and Citrus tatter leaf virus (CTLV), respectively. The sap of CCDaV-infected and healthy citrus leaf samples were diluted by multiple ratio (1∶20, 1∶40, 1∶80, 1∶ 160, 1∶320, 1∶640, 1∶1280) to determine the sensitivity of dot-ELISA. Citrus leaf samples collected from Chongqing municipality and Guangxi province were tested for CCDaV infection using the dot-ELISA and PCR to test the applicability of the established dot-ELISA.【Results】The result showed that the full sequence of CP gene was 762 bp, encoding 253 amino acids. The prokaryotic expression plas-mid pET28a-CCDaV-CP was successfully constructed, and the target fusion protein (CCDaV-CP) was highly expressed in E. coli induced by 0.5 mmol IPTG at 18 ℃. The expressed protein was identified and purified, and then used to immune rabbit. Finally, the specific antiserum was prepared and it could strongly and specifically react with an approximately 25 ku of CCDaV CP by Western blot, with the op-timal titer of the antiserum being 1∶3000. Furthermore, no hybridization signal was observed on the lane of pET28a vector or Rosetta strain. The results also showed that the optimum reaction conditions of established dot-ELISA were 1∶4000 for the antiserum and 1∶10 000 for goat anti-rabbit IgG labeled by Alkaline Phosphatase (AP) AffiniPure. In the specific test, only CCDaV-infected samples were positive, and the rest of samples were negative. In the sensitivity detection, the established dot-ELISA could detect CCDaV in citrus sap diluted at 1∶640 (ρ, g · mL- 1). Among the 42 field CCDaV-suspected sam-ples, the detection rate by dot-ELISA was 42.8%, which was lower than that by PCR (45.2%). All sam-ples that were tested positive with dot-ELISA were also tested positive with PCR. One dot-ELISA nega-tive sample was also positive by PCR. These results suggested that the dot-ELISA method established in this study was sensitive and reliable.【Conclusion】In the study, the optimal conditions were ex-plored for prokaryotic expression and the specific antisera was prepared for detection of pET28a-CCDaV-CP. This is the first report of prepared antiserum against CCDaV and a dot-ELISA method for CCDaV detection. The detection results showed that the developed dot- ELISA could accurately, reliably and sensitively detect CCDaV in citrus samples and will facilitate the implementation of citrus budwood certification programs to screen plants in nurseries. The assay will also be useful for studying on the etiology of CCDaV, scientific prevention and control of CCDaV in China. Key words: Citrus chlorotic dwarf-associated virus; Coat protein; Antiserum; Dot enzyme linked im-munosorbant assay