Occurrence, distribution and molecular characteristics of Citrus chlorotic dwarf-associated virus in Chongqing

Abstract:【Objective】In 2015, an emerging citrus viral disease caused by Citrus chlorotic dwarf-associated virus (CCDaV) was first reported in Yunnan province of China, followed by Guangxi and Guangdong provinces. The present study was undertaken to provide further insight into the distribution of CCDaV in Chongqing municipality, and get a more complete overview of the molecular variability of CCDaV.【Methods】The field survey and collection of samples were conducted from January 2020 to December 2021 in 8 counties of Chongqing municipality, including Beibei, Wanzhou, Jiangjin, etc. A total of 361 suspected CCDaV-infected pummelo and lemon samples were collected from 27 orchards. The samples were randomly evaluated both on normal appearance and on virus-like symptoms of a Vshaped notch and chlorotic freckling on leaves. During sampling, the symptoms on leaves were carefully observed. Total DNA extracts were obtained from each plant with DNA extraction kit and used for PCR detection with specific CCDaV primers (sense: 5’- GAGCATGTTGAGTGTGAGG -3’and antisense (5’- CAGACATAT CCATCAGCGC -3’), which were based on the conserved region of movement protein of CCDaV (Genbank accession No. JQ920490). For cloning, three CCDaV-positive samples were selected. The complete genome of CCDaV was amplified by using one pair of primers (3202F: 5’- GTTCTGTGTTTCGACCCGTTTCTTGCACTGG -3’and 3202R (5’-CCCCGGTTCTTCGACCTCCTCTCCGTA-3’), designed based on the CCDaV genome (No. JQ920490), as previously described. PCR amplified matters were purified with EasyPure quick gel Extraction kit and cloned into pCE2 TA/Blunt-Zero vector. Twelve randomly selected positive clones were custom sequenced. The genomic sequences were assembled by using SeqMan software and submitted to GenBank under accession numbers ON063221- ON063223. Multiple nucleotide sequence alignments of the complete genome of the 3 CCDaV isolates from this study, and 41 CCDaV isolates available in GenBank were conducted separately with Megalign, and the sequence identities were calculated using SDTv.1.2. MEGA 11 was used to construct neighbor-joining phylogenetic trees with 1000 bootstrap replicates. Furthermore, complete genomes of the 44 CCDaV isolates were used for recombination analysis, which was performed with the RDP v4.97 software package.【Results】CCDaV was detected from 0.83% of the collected samples in Chongqing municipality (3 samples were positive out of the 361 samples surveyed) and all of them were originated from Ruby Green pomelo (Citrus grandis) in Wuxi. CCDaV was not found on other pomelo or lemon species. The results showed that CCDaV was not widely distributed in Chongqing municipality. In this study, the young shoots of CCDaV-infected Ruby Green pomelo showed severe leaf twist, shrink and yellowing symptoms. Mild inverted cupping and shrink symptoms were observed on some of Ruby Green pomelo plants, in which CCDaV was not detected, but no variegation symptoms were found in CCDaV-negative plants. The complete genomes of the WX-2-5 had the lengths of 3642 nucleotides (nt) and the base composition was 27.6% A, 16.8% C, 27.3% G and 28.4% T. The complete genomes of the WX- 4- 6 had the lengths of 3640 nt and the base composition was 27.6% A, 16.7% C, 27.5% G and 28.3% T. The complete genomes of the WX-4-9 had the lengths of 3641 nt and the base composition was 27.6% A, 16.7% C, 27.4% G and 28.3% T. The 5’and 3’untranslated regions (UTRs) of the three CCDaV isolates were 194 nt and 220 nt, respectively. The genome organization of all these CCDaV isolates was consistent with that published before. Compared with the CCDaV isolate WX-4-6, WX-4-9 had additional base (T) at position 1203, and WX-2-5 had two more bases (TT) at 1203 and 1204 nt. The amino acid sequence alignment showed that there were 4 point mutations at amino acid sequences between WX-2-5 and 41 known CCDaV isolates at positions 303 (C→L), 304 (I→H), 341 (S→N) and 1163 (F→ S). There were 3 same point mutations in the amino acid sequences between WX-4-6 and 41 CCDaV isolates at 43 (L →W), 567 (H→R) and 722 (R→C). In addition to the same mutation as WX-4-6, WX-4-9 also had mutations at positions 633 (S→N) and 1137 (R→M). Comparisons of the whole genome sequences of the 3 CCDaV isolates from this study as well as 41 isolates previously reported from around the world revealed that the sequence identity ranged from 99.1% to 99.7% at nucleotide level and 97.3% to 99.7% at amino acid level, respectively, indicating that there was a very low level of sequence heterogeneity among CCDaV isolates. No recombination event was found among these 44 CCDaV strains. Phylogenetic tree analysis showed that these 44 CCDaV isolates belonged to four different groups based on geographical origins and host species. CCDaV isolates from China were phylogenetically distinct from the isolates from Turkey, and the CCDaV isolates from Turkey were clustered together in the same branch. CCDaV isolates from Thailand, except CCDaV isolate Tha 30, were all clustered with Chinese CCDaV isolates from pomelo. CCDaV isolates WX- 4- 6 and WX- 4- 9 were clustered together with CCDaV isolates on Shatian pomelo from Guangdong province, and CCDaV isolate WX-2-5 strains were clustered in another branch. CCDaV isolates from China and Thailand were more closely related than those from Turkey.【Conclusion】To our knowledge, this is the first report of CCDaV in Chongqing, and the movement of CCDaV-infected planting materials was probably one of the important routes of CCDaV transmission in Chongqing.