Cloning of miR408b target gene Chemocyanin and analysis of its expression under cold stress in banana

Abstract:【Objective】miR408 is a highly conserved miRNA family, the length is about 21 nt, and play an important role in plant responses to stresses. When plants are subjected to biotic or abiotic stress, the expression of miR408 and target genes in plants will be affected. According to the previous researches, over expression of miR408 in Arabidopsis could improve cold tolerance and antioxidant capacity. And the regulation of target gene expression of miR408 could improve plant resistance, TaCLP1(chemocyanin-like protein) is a target gene of miR408 in wheat, coding plastocyanin protein, and overexpression of TaCLP1 can enhance resistance of wheat to diseases, salt and copper stress. Banana, an important food crop in subtropical area. The yield and quality of the fruit can be seriously affected by the low temperature. Therefore, we investigated the expression pattern and regulation mechanism of miR408 b and its target gene Chemocyanin in banana under low temperature stress.【Methods】The target gene of miR408 b in banana was predicted using online software(http://plantgrn.noble.org/ps RNATarget), selecting high score responding to the stress taget gene—Chemocyanin. The leaves of wild banana of Sanming city, and‘Tianbao'banana were used as materials to clone the Chemocyanin by RT-PCR and RACE methods, named MiCHY and MaCHY, respectively. 5'RLM-RACE(RNA ligase-mediated amplification of cDNA ends) was used to identify the site of miR408 b cleavage of the target gene MiCHY. The physicochemical properties, subcellular localization, signal peptide prediction, phosphorylation site prediction, phosphorylation site prediction, protein secondary structure, and gene structure analysis of MiCHY protein were analyzed using online software. The Chemocyanin protein was searched by BLASTP in the NCBI database, and the Chemocyanin protein sequences of different plants with higher homology were downloaded, multiple sequence alignment of these sequences was performed by DNAMAN. And the phylogenetic tree was constructed under the default parameters by MEGA 6.0 through NJ method(Neighbor-Joining). Finally the expression of miR408 b and its target genes Chemocyanin under different low temperature treatments by qRT-PCR. The quantitative primers of miR408 b were designed by stem-loop method. U6 snRNA was used as the internal reference of real-time fluorescent quantitative PCR; the CAC gene was used as the internal reference gene to detect the expression level of the target gene Chemocyanin. The experiment was performed on a Roche Light Cycler 480 fluorescence quantitative qPCR instrument, and the expression was calculated by 2-△△ Ctmethod. The data processing and differential significance analysis were performed by Excel and SPSS. The qRT-PCR test materials were the seedlings cultured in vitro of wild banana and‘Tianbao'banana with consistent growth were selected and transferred into the light incubator for low temperature treatment at 0, 4, 13 and 28 ℃ as control.【Results】The full-length cDNA of MiCHY was 587 bp, open reading frame(ORF) was 381 bp,encoding 126 amino acid protein, and had a plantacyanin domain, belonging to the cupredoxin superfamily. There was a highly matched miR408 b binding site(GCTCAGGGAAGGGGCAGTGCG) at the4-24 bp of the ORF region. RLM-5'RACE analysis showed that miR408 b mainly cleaved the target gene MiCHY mRNA between the 7 th and 8 th bases of the target sequence. Sequence alignment showed that The sequence of the MaCHY was 82 bp longer than that of the MiCHY, which was consistent with the intron GT-AG cleavage, suggesting that alternative splicing of intron retention occurred in‘Tianbao'. The results of qRT-PCR showed that in the cold-sensitive‘Tianbao'banana, the expression of miR408 b increased and the expression of MaCHY decreased under low temperature stress. On the contrary, in the cold-resistant Sanming of the wild banana under low temperature stress, the expression of the miR408 b decreased, and the expression of the MiCHY increased. The expression levels of the MiCHY, the MaCHY and the miR408 b were negatively correlated, which further indicated that the MiCHY and the MaCHY were the target genes of miR408 b in banana. Expression analysis of different tissue parts under 4 ℃ under low temperature stress, the expression of the miR408 b in the leaves was higher than that of pseudostems. The expression level of the target gene MaCHY was higher than that of the pseudostem. In Sanming wild banana, the expression level of the miR408 b was almost the same in leaves and pseudostems, but the expression level of the MiCHY in the pseudostems was significantly larger than that in the leaves.【Conclusion】The MiCHY may play a role in the response of banana to low temperature stress.